View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_62 (Length: 243)
Name: NF5039_low_62
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 24566481 - 24566643
Alignment:
| Q |
1 |
ataaacacacagaaaaacaacttgataaaattcagtttcatcaattcaagtgatcgtaatttcataaatcgtatcttgtccatatctgttacccgtcaat |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566481 |
ataaacacacaggaaaacaacttgataaaattcagtttcatcaattcaagtgatcataatttcataaatcgtatcttgtccatatctgttacccgtcaat |
24566580 |
T |
 |
| Q |
101 |
tgtcaaatcaaatatgttcacgtgatggatacttccataagataaagaaggtaacttgttatg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566581 |
tgtcaaatcaaatatgttcacgtgatggatacttccataagataaagaaggtaacttgttatg |
24566643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 3 - 54
Target Start/End: Complemental strand, 45532510 - 45532459
Alignment:
| Q |
3 |
aaacacacagaaaaacaacttgataaaattcagtttcatcaattcaagtgat |
54 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45532510 |
aaacacacaggaaaaaaacttgataaaattcagtttcataaattcaagtgat |
45532459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University