View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_65 (Length: 241)
Name: NF5039_low_65
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9423660 - 9423428
Alignment:
| Q |
1 |
atatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagttgttgttttcaactctccaatctattttgagagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
9423660 |
atatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagtttttgttttcaactcttcaatctattttgagagaa |
9423561 |
T |
 |
| Q |
101 |
atactattttttctttcatagtcgtggagcagaaaatatcgtatatctttttcaaactttaaatgtggacttttagatcgtatggtttgcgtcatgaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9423560 |
atactattttttctttcatagtcgtggagcagaaaatatcttatatctttttcaaactttaaatgtagacttttagatcgtatggtttgcgtcatgaaca |
9423461 |
T |
 |
| Q |
201 |
actaattcaataatctatcgtcactagtattat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9423460 |
actaattcaataatctatcgtcactagtattat |
9423428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 9418328 - 9418420
Alignment:
| Q |
1 |
atatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagttgttgttttcaactctccaatctatttt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
9418328 |
atatcttgttttggttctgaatattttgaaccggtctggtcaacacaactaacatgaagttgagtttttgttttcaactcttcaatctatttt |
9418420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University