View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_67 (Length: 239)
Name: NF5039_low_67
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 21008649 - 21008429
Alignment:
| Q |
16 |
atatagtcaaggacaggtaaagagaggtcacatggatagtcttctccataggagacaagtagatgaggagagtgcatggcattgttcaaaaatagtttac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21008649 |
atatagtcaaggacaggtaaagagaggtcacatggatagtcttctccataggagacaagtagatgaggagagtgcatggcattgttcaaaaatagtttgc |
21008550 |
T |
 |
| Q |
116 |
aaggttttaaattgtaggaatggtcctatagctatctttgatcattgaaaaaattgttttgatcaaatacaattaataaggactcaattgcaatcacgtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
21008549 |
aaggttttaaattgtaggaatggtcctatagctatctatgatcattcaaaaaattgttgtgatcaaatacaattaatgagggctcaattgcaatcacgtt |
21008450 |
T |
 |
| Q |
216 |
gaggttgcagcgacggtgaaa |
236 |
Q |
| |
|
|| ||||| |||||||||||| |
|
|
| T |
21008449 |
gaagttgcggcgacggtgaaa |
21008429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 35451895 - 35451931
Alignment:
| Q |
42 |
gtcacatggatagtcttctccataggagacaagtaga |
78 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35451895 |
gtcacatggatagtcatctccataggagacaagtaga |
35451931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University