View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_76 (Length: 232)
Name: NF5039_low_76
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 49 - 128
Target Start/End: Original strand, 23891805 - 23891884
Alignment:
| Q |
49 |
aacctccggtgattatacaaaacgaagatagaagactatgactccaattttgattatatgttttgctttcaattgattct |
128 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
23891805 |
aacctccggtatttattcaaaacgaagatagaagactatgactccaattttgatgatctgttttgctttcaattgattct |
23891884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 73 - 128
Target Start/End: Original strand, 30801536 - 30801591
Alignment:
| Q |
73 |
aagatagaagactatgactccaattttgattatatgttttgctttcaattgattct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
30801536 |
aagatagaagactatgactccaattttgatgatctgttttgctttcaattgattct |
30801591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University