View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5039_low_78 (Length: 225)

Name: NF5039_low_78
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5039_low_78
NF5039_low_78
[»] chr8 (1 HSPs)
chr8 (109-207)||(32738155-32738253)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 109 - 207
Target Start/End: Original strand, 32738155 - 32738253
Alignment:
109 gattaattgattctattgagaaatgaaatatgtcacctgagaaattagacacataattatgaaaagtggtgctctttttcaagtcctggcgtgtgtcaa 207  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
32738155 gattaattgattctattgagaaacgaaatatgtcacctgagaaattagacacataattatcaaaagtggtgctctttttcaagtcctggcgtgtgtcaa 32738253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University