View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5039_low_79 (Length: 223)

Name: NF5039_low_79
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5039_low_79
NF5039_low_79
[»] chr5 (2 HSPs)
chr5 (13-106)||(7446740-7446833)
chr5 (177-206)||(7446647-7446676)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 13 - 106
Target Start/End: Complemental strand, 7446833 - 7446740
Alignment:
13 gtgagatgaaatatcgtgtggctgagaagtgaaaacttaataatgtacggtttggatatcatcgagcccagagctcatatgaacgaacgttcat 106  Q
    |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
7446833 gtgacatgaaatatcgtgtggctgagtagtgaaaacttaataatgtacggtttggatttcatcgagcccagagctcatatgaacgaacgttcat 7446740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 7446676 - 7446647
Alignment:
177 gtcctaaagaaccggttgcatgctagtgtt 206  Q
    ||||||||||||||||||||||||||||||    
7446676 gtcctaaagaaccggttgcatgctagtgtt 7446647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University