View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_79 (Length: 223)
Name: NF5039_low_79
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 13 - 106
Target Start/End: Complemental strand, 7446833 - 7446740
Alignment:
| Q |
13 |
gtgagatgaaatatcgtgtggctgagaagtgaaaacttaataatgtacggtttggatatcatcgagcccagagctcatatgaacgaacgttcat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7446833 |
gtgacatgaaatatcgtgtggctgagtagtgaaaacttaataatgtacggtttggatttcatcgagcccagagctcatatgaacgaacgttcat |
7446740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 7446676 - 7446647
Alignment:
| Q |
177 |
gtcctaaagaaccggttgcatgctagtgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7446676 |
gtcctaaagaaccggttgcatgctagtgtt |
7446647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University