View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5039_low_82 (Length: 204)
Name: NF5039_low_82
Description: NF5039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5039_low_82 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 52762169 - 52761977
Alignment:
| Q |
11 |
tcagaacctgtgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatg |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762169 |
tcagaacctatgcaacttgttcaattgatcattccaattgaatcagctcagcgatccatctcttaccttggcgatctcggcctttttcaattcaaagatg |
52762070 |
T |
|
| Q |
111 |
tatgaatcctttaattaccaatctttgtcctttctcactttgcattcttgcgtacgcttcggactacgttttgcataatgttgatatgttcttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
52762069 |
tatgaatcctttaattaccaatctttgtcc-ttctcactttgtattctttatgacgcttcggactacattttccataatgttgagatgttcttc |
52761977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University