View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5040_high_19 (Length: 242)
Name: NF5040_high_19
Description: NF5040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5040_high_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 242
Target Start/End: Complemental strand, 26505907 - 26505671
Alignment:
| Q |
6 |
accaaggccttgtggacgaggaaacgatcagatatcgatatgttaggtgtagaccaaaagtggaatgagatgatagggccatgtttagcatggaggttgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
26505907 |
accaaggccttgtggacgaggaaacgatcagatatcgatatgttaggtgtagaccaaaagtggaatgagatgatagggccatgtctggcatgaaggttgc |
26505808 |
T |
|
| Q |
106 |
gaagaattggctcgagttgtgggaatgattttcgtagccataggatatcggaaatgaaaggaaaatggattggtccaggagggagttgaattgatttgag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26505807 |
gaagaattggctcgagttgtgggaatgatttccgtagccataggatatcggaaatgaaaggaaaatggaatggtccaggagggagttgaattgatttgag |
26505708 |
T |
|
| Q |
206 |
ggatcttatacttgtgataataagtattgaaagacac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26505707 |
ggatcttatacttgtgataataagtattgaaagacac |
26505671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University