View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5040_high_20 (Length: 233)
Name: NF5040_high_20
Description: NF5040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5040_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 10027119 - 10026942
Alignment:
| Q |
19 |
tcaacaacctcacacgtgtggcatcatcatcaaaacgcaccgtttcgctcagtttaaacaatagcggtggtggttataagtttaggaatattcttcatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10027119 |
tcaacaacctcacacgtgtggcatcatcatcaaaacgcaccgtttcactcagtttaaacaatagcggtggtggttataagtttaggaatattcttcatga |
10027020 |
T |
|
| Q |
119 |
ttttaatagagctgttagggttcattgtgagaggatgccgattggattcgcttcgttgagagtaggtgatggaggtga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10027019 |
ttttaatagagctgttagggttcattgtgagaggatgccgattggattcgcttcgttgagagtaggtgatggaggtga |
10026942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 3328645 - 3328468
Alignment:
| Q |
19 |
tcaacaacctcacacgtgtggcatcatcatcaaaacgcaccgtttcgctcagtttaaacaatagcggtggtggttataagtttaggaatattcttcatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3328645 |
tcaacaacctcacacgtgtggcatcatcatcaaaacgcaccgtttcactcagtttaaacaatagcggtggtggttataagtttaggaatattcttcatga |
3328546 |
T |
|
| Q |
119 |
ttttaatagagctgttagggttcattgtgagaggatgccgattggattcgcttcgttgagagtaggtgatggaggtga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3328545 |
ttttaatagagctgttagggttcattgtgagaggatgccgattggattcgcttcgttgagagtaggtgatggaggtga |
3328468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University