View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5041_low_2 (Length: 234)
Name: NF5041_low_2
Description: NF5041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5041_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 40670553 - 40670774
Alignment:
| Q |
1 |
ttacattttaaattgttacaaaaaataattattatgtatagtaaagattaatataatgtaagagacctgtgtcccatgtggagtaaggttggtttctcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40670553 |
ttacattttaaattgttacaaaaaataattattatgtatagtaaagattaatataatgtaagagacctgtgtcccatgtgtagtaaggttggtttctcta |
40670652 |
T |
|
| Q |
101 |
cacaagttcctcacgttttgttttcttttgtctattctaattgttggttggctttggaattcggacgcttttatagtaattttttgtactacaaattttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40670653 |
cacaagttcctcacgttttgttttcttttgtctattttaattgttggttggctttggaattcggacgcttctatagtaattttttgtactacaaattttc |
40670752 |
T |
|
| Q |
201 |
tgaagaagtttaagaaccaagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40670753 |
tgaagaagtttaagaaccaagt |
40670774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 145
Target Start/End: Original strand, 10314917 - 10314978
Alignment:
| Q |
85 |
aaggttggtttctctacacaagtt-cctcacgttttgttttcttttgtctattctaattgtt |
145 |
Q |
| |
|
||||||||||||||||| || || |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10314917 |
aaggttggtttctctactcatgtcacctcactttttgttttcttttgtctattctaattgtt |
10314978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University