View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042-Insertion-17 (Length: 186)
Name: NF5042-Insertion-17
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042-Insertion-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 12874726 - 12874545
Alignment:
| Q |
8 |
gatttgaacattgacacatattatctaccaatatataatcgacacct---ataaacatgacattgatagagatagaaattggaacaattttatcnnnnnn |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12874726 |
gatttgaacattgacacgtattatctaccaatatataatcgacaccttctataaacacgacattgatagagatagaaattggaacaattttatcaaaaaa |
12874627 |
T |
|
| Q |
105 |
nnnnnnncaaactatatattataagatgctcatattctgttccccgacttccccaatgaactctcttggcctttctacacac |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12874626 |
agaaaaacaaactatatattataagatgctcatattctgttccccgacttccccaatgaactctcttggcctttctacacac |
12874545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University