View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042-Insertion-19 (Length: 125)
Name: NF5042-Insertion-19
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042-Insertion-19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 9616050 - 9616166
Alignment:
| Q |
8 |
agtttgtctagtggttccactatgcaagtatcattttttaacaactcgctcaatgtaagacctctaattggccattcaacactcaatgtaagaactctaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9616050 |
agtttgtctagtggttccactatgcaa-tatcatttttaaacaactcgctcaatgtaagaactctaattggccattcaacactcaatgtaagaactctga |
9616148 |
T |
 |
| Q |
108 |
ttgggtctcctttaggca |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9616149 |
ttgggtctcctttaggca |
9616166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University