View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_high_12 (Length: 403)
Name: NF5042_high_12
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 107 - 376
Target Start/End: Original strand, 37705243 - 37705512
Alignment:
| Q |
107 |
tacaccttgttgcagtaaagtagggttgaagagaggaccatggactgtagaagaagatgaagttttatcagaatacatcaaaaaagaaggtgaaggtcgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37705243 |
tacaccttgttgcagtaaagtagggttgaagagaggaccgtggactgtagaagaagatgaagttttatcagaatacatcaaaaaagaaggtgaaggtcgt |
37705342 |
T |
|
| Q |
207 |
tggagaactcttcccaaacgagctggtcttctccgttgcggcaaaagctgtcgtctccgttggatgaattatcttcgtccatccgtcaaacgcggtcaga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37705343 |
tggagaactcttcccaaacgagctggtcttctccgttgcggcaaaagctgtcgtctccgttggatgaattatcttcgtccatccgtcaaacgcggtcaga |
37705442 |
T |
|
| Q |
307 |
tcgctcctgatgaagaagatctcatcctccgcctccaccgtcttctcggcaacaggtttacataatcatt |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37705443 |
tcgctcctgatgaagaagatctcatcctccgcctccaccgtcttctcggcaacaggtttacataatcatt |
37705512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University