View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_high_20 (Length: 287)
Name: NF5042_high_20
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 278
Target Start/End: Complemental strand, 32670321 - 32670045
Alignment:
| Q |
20 |
ctaatccataccaattagtttccgatatcatagccatcgattcatcattaacttgatcgaaagatgacataagtgaagaaacatcgtcagaagaaaccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670321 |
ctaatccataccaattagtttccgatatcatagccatcgattcatcattaacttgatcgaaagatgacataagtgaagaaacatcgtcagaagaaaccat |
32670222 |
T |
 |
| Q |
120 |
tgatgatggagatgataccaatgatgatgaagagggagtgttagcattatcattgac------------------attattgttgtcaatgaaactattc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
32670221 |
tgatgatggagatgataccaatgatgatgaagagggagtgttagcattatcattgacattaacattaacattattattattgttgtcgatgaaactattc |
32670122 |
T |
 |
| Q |
202 |
gcggcagctgcagcaactctttgaattgatttcggagacatatcttgaggaatattgtaatgtgaagatgatgatgt |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670121 |
gcggcagctgcagctactctttgaattgattttggagacatatcttgaggaatattgtaatgtgaagatgatgatgt |
32670045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University