View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_low_18 (Length: 360)
Name: NF5042_low_18
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 104 - 211
Target Start/End: Complemental strand, 759693 - 759587
Alignment:
| Q |
104 |
gacataactccaaagaaaaataatttatcttttaattagacacaccattatgtcaactctttggagctaatttgaagctatttagttaaggattgagaca |
203 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
759693 |
gacataactccaaagaaaaaaaatt-atcttttaattagacacaccattatgtcaactctttggagctaatttgaagctatttagttaaggattgagaca |
759595 |
T |
|
| Q |
204 |
tcttcacc |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
759594 |
tcttcacc |
759587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 214 - 335
Target Start/End: Complemental strand, 758475 - 758350
Alignment:
| Q |
214 |
attcttattaaaaatg-agctaatcataggagacctattgtaaaagtgcatgagcaattgttttgtctttctttagcactttt---attgaatgttgtaa |
309 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||| |||||||| ||||||||||||||| || ||| |||||||||||| | | || ||| ||||| |
|
|
| T |
758475 |
attcttattaagaatggagctaatcataggtgacctcttgtaaaaatgcatgagcaattgtcttatctctctttagcacttcttctagtggatgctgtaa |
758376 |
T |
|
| Q |
310 |
gagtgtcatttattaggacgtagtta |
335 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
758375 |
gagtgtcatttattaagacgtagtta |
758350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University