View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_low_19 (Length: 327)
Name: NF5042_low_19
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 8736656 - 8736957
Alignment:
| Q |
16 |
aaaacgaacctctaaccacttacttaaaatgtacaagcccctttcaaagtttatttaattgtttgacgacttctccgtaatcgtttttcaacaaaggaca |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8736656 |
aaaacaaacctctaaccacttacttaaaatgtacaagcccctttcaaagtttatttaattgtttgacggcttctccgtaatcgtttttcaacaaaggaca |
8736755 |
T |
 |
| Q |
116 |
atttgcttagacgcgacattattcaccaatatcataatacttgtgttagtggttgtgccgtgaaggaatcgacagaacatctatttttgtgttgtcatca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8736756 |
atttgcttagacgcgacattattcaccaatatcataatacttgtgttagtggttgtgtcgtgaaggaatcgacagaacatctgtttttgtgttgtcatca |
8736855 |
T |
 |
| Q |
216 |
tttcggtagtctttgacttatgattcataattggattggtttttcaactgctgatccattttgtattcagatcattttacactgttttgtattcagatca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8736856 |
tttcggtagtctttgacttatgattcataattggattggtttttcaactgctgatccattttgtattcagatcattttacaccgttttgtattcagatca |
8736955 |
T |
 |
| Q |
316 |
tt |
317 |
Q |
| |
|
|| |
|
|
| T |
8736956 |
tt |
8736957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University