View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_low_25 (Length: 274)
Name: NF5042_low_25
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 274
Target Start/End: Complemental strand, 43447102 - 43446845
Alignment:
| Q |
25 |
tagattacaaagagatagagtaaatttgtgtttctggctttatatgccgttcattttgctgagtaaagtgaacggtgacaaccacgtcaccctcacttac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43447102 |
tagattacaaagagatagagtaaatttgtgtttctggctttatatgccgttcattttgct-agtaaagtgaacggtgacaaccacgtcaccctcacttac |
43447004 |
T |
 |
| Q |
125 |
aagaaactttttaaagtcac--------aaattttataattacgtacgtattta-ttataaaatcttcaacggcaattttttgtgtaccttgaatagaaa |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43447003 |
aagaaactttttaaagtcacttacttacaaattttataattacgtacgtatttaattataaaatcttcaacggcaattttttgtgtaccttgaatagaaa |
43446904 |
T |
 |
| Q |
216 |
atctaagaagataaacaaaatcttacttgtaatagtaattcagatgaggtccaagtcat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43446903 |
atctaagaagataaacaaaatcttacttgtaatagtaattcagatgaggtccaagtcat |
43446845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University