View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_low_34 (Length: 244)
Name: NF5042_low_34
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 17 - 154
Target Start/End: Complemental strand, 42061966 - 42061829
Alignment:
| Q |
17 |
agacacagctattttaggatgatgatgcatgtaaaggagttgaagttggttaggtttagttaccaaaattagggtcgtaaaacttttaatttttatttct |
116 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42061966 |
agacgcagctattttaggatgatggtgcatgtaaaggagttgaagttggttgggtttagttaccaaaattagggttgtaaaactttttatttttatttct |
42061867 |
T |
 |
| Q |
117 |
gagggaagcattgtaaaactactattcatcaattggga |
154 |
Q |
| |
|
|||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
42061866 |
gaggaaagcgttgtaaaactattattcatcaattggga |
42061829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 111
Target Start/End: Complemental strand, 42055533 - 42055428
Alignment:
| Q |
6 |
cacagacacgcagacacagctattttaggatgatgatgcatgtaaaggagttgaagttggttaggtttagttaccaaaattagggtcgtaaaacttttaa |
105 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
42055533 |
cacagacacacagacgcagctattttaggatgatgatgcatgcaaaggagttgaagttgattaggtttagttaccaaaatttgggttgtaaaacttttat |
42055434 |
T |
 |
| Q |
106 |
ttttta |
111 |
Q |
| |
|
|||||| |
|
|
| T |
42055433 |
ttttta |
42055428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 154
Target Start/End: Complemental strand, 42054520 - 42054485
Alignment:
| Q |
119 |
gggaagcattgtaaaactactattcatcaattggga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42054520 |
gggaagcattgtaaaactactattcatcaattggga |
42054485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University