View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5042_low_37 (Length: 240)
Name: NF5042_low_37
Description: NF5042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5042_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 12079460 - 12079242
Alignment:
| Q |
3 |
caaggactagacttgtacgacaaccatttaaccggtccaataccggacagcttcggatcattcaaggctggttctcaggtcaccttgtccaacaacatgt |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12079460 |
caaggactaaacttgtacgacaaccatttaaccggtccaataccggacagcttcggatcattcaaggccggttctcaggtcactttgtccaacaacatgt |
12079361 |
T |
|
| Q |
103 |
tatccggaccaatcccaagatcgttgggcacagttaatttcagcattttcgaggctgctgggaaccggttgaccggtgatgcatcgttcttgttcgggaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12079360 |
tatccggaccaatcccaagatcgttgggcacagttaatttcagtattttcgaggctgctgggaaccggttgaccggtgatgcatcgttcttgttcgggaa |
12079261 |
T |
|
| Q |
203 |
agataagactgagttggct |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12079260 |
agataagactgagttggct |
12079242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 12096102 - 12095882
Alignment:
| Q |
1 |
tccaaggactagacttgtacgacaaccatttaaccggtccaataccggacagcttcggatcattcaaggctggttctcaggtcaccttgtccaacaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12096102 |
tccaaggactagacttgtacgacaaccatttaaccggtccaataccggacagcttcggatcattcaaggccggttctcaggtcactttgtccaacaacat |
12096003 |
T |
|
| Q |
101 |
gttatccggaccaatcccaagatcgttgggcacagttaatttcagcattttcgaggctgctgggaaccggttgaccggtgatgcatcgttcttgttcggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
12096002 |
gttatccggaccaatcccaagatcgttgggcaaagttaatttcagtattttcgaggctgctgggaaccagttgaccggtgatgcgtctttcttgttcggg |
12095903 |
T |
|
| Q |
201 |
aaagataagactgagttggct |
221 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
12095902 |
gaaagtaagactgagttggct |
12095882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University