View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5045_low_1 (Length: 358)
Name: NF5045_low_1
Description: NF5045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5045_low_1 |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0150 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 41380043 - 41379993
Alignment:
| Q |
196 |
catcccaatcatcttcatcttcatccgcttcatcatctttatttgccacgg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41380043 |
catcccaatcatcttcatcttcatccgcttcatcatctttatttgtcacgg |
41379993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 41380231 - 41380174
Alignment:
| Q |
15 |
cagagacacacaaacacacgc--gactcaacaactaggtcagccagcttatacatccc |
70 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41380231 |
cagaaacacacaaacacacgcacgactcaacaactaggtcagccagcttatatatccc |
41380174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 11969 - 11919
Alignment:
| Q |
196 |
catcccaatcatcttcatcttcatccgcttcatcatctttatttgccacgg |
246 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
11969 |
catcccaatcatcatcgtcttcatccgcttcatcatctttatttgtcacgg |
11919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0150
Description:
Target: scaffold0150; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 38814 - 38764
Alignment:
| Q |
196 |
catcccaatcatcttcatcttcatccgcttcatcatctttatttgccacgg |
246 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
38814 |
catcccaatcatcgtcgtcttcatccgcttcatcatctttatttgtcacgg |
38764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University