View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5046-Insertion-13 (Length: 62)
Name: NF5046-Insertion-13
Description: NF5046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5046-Insertion-13 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 2e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 39002566 - 39002620
Alignment:
| Q |
8 |
catttctcataaggaaaattcctgatgtattcttggattcctacatgttgcgtaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002566 |
catttctcataaggaaaattcctgatgtattcttggattcctacatgttgcgtaa |
39002620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 38997907 - 38997947
Alignment:
| Q |
10 |
tttctcataaggaaaattcctgatgtattcttggattccta |
50 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
38997907 |
tttctcataaggaaaattcctgatgtactcatggattccta |
38997947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University