View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5047_low_2 (Length: 255)
Name: NF5047_low_2
Description: NF5047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5047_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 29663284 - 29663057
Alignment:
| Q |
20 |
agtaggcatatagaacatagattatttacagactaaaccccatgcattaatttgattaatggtttccatgatttggactaagaaagcaaaacagtgaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663284 |
agtaggcatatagaacatagattatttacagactaaaccccatgcattaatttgattaatggtttccatgatttggactaagaaagcaaaacagtgaaat |
29663185 |
T |
|
| Q |
120 |
cctacaccaaaatgtggttttgatttcacaatgaaacctaacctaagaagaaatagtagtagctacatatcaggggatgaaattggtcccagataatccc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29663184 |
cctacaccaaaatgtggttttgatttcacaatgaaacctaacctaagaagaaatagtagtagctacatatcaggggatgaaattgatcccagataatccc |
29663085 |
T |
|
| Q |
220 |
cttccaagccatgaaactccctctctgc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29663084 |
cttccaagccatgaaactccctctctgc |
29663057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 180 - 230
Target Start/End: Original strand, 33201324 - 33201374
Alignment:
| Q |
180 |
agctacatatcaggggatgaaattggtcccagataatccccttccaagcca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33201324 |
agctacatatcaggggatgaaattggtcctagataatccccttccaagcca |
33201374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University