View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5050-Insertion-2 (Length: 372)
Name: NF5050-Insertion-2
Description: NF5050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5050-Insertion-2 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 347
Target Start/End: Complemental strand, 503698 - 503362
Alignment:
| Q |
7 |
acttttcgcccatgaggacacctttggtagatattgacaaagcatttgagttattgaaagatcccacttgtgtcaaagttgttatgaagatgttatatct |
106 |
Q |
| |
|
||||||| ||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
503698 |
acttttcacccatgaggtc-cctttggttgatattgacaaagcatttgagttattgaaagatcccacttgtgtcaaagttgttatcaagatgtgatatct |
503600 |
T |
|
| Q |
107 |
ttctttccatatcccagcttatttcaataaactctctcaagaaaatattagagatgttatttctgcttttttaaaattagaaattaatgtactgatcata |
206 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
503599 |
ttctttccat--cccagcatatttcaataaactctc--aagaaaatattagagatgttatttcagcttttttaaaattagaaattaatgtactgatcatc |
503504 |
T |
|
| Q |
207 |
attctcgtggtttctctactctatggagaatgatgttattatgtgatcgcaatcaatttctctcttttactcttgcgagcatatgctttccctac-tttt |
305 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||| || |||||||||| || | |||| |
|
|
| T |
503503 |
gttcttgtggtttctctattctatggagaatgatgttattatgtgatcacaatcaatttctctcttttattcttatgaaaatatgctttctcttcttttt |
503404 |
T |
|
| Q |
306 |
ttaaatgacatgccttctcttctaaacggcaacatcccctat |
347 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
503403 |
tttaatgacatgctttctcttctaaacggcaacatcccctat |
503362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University