View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5050_low_3 (Length: 431)
Name: NF5050_low_3
Description: NF5050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5050_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 204 - 414
Target Start/End: Complemental strand, 41779525 - 41779319
Alignment:
| Q |
204 |
cagatttgatctaataagaactactaatttgacagttaattaaatctataagcttgtttacaaagtttttgagcagagaactactcttggactaagttga |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41779525 |
cagatttgatctaataagaactactaatttgacagttaa----atctataagcttgtttacaaagtttttgagcagagaactactcttggactaagttga |
41779430 |
T |
|
| Q |
304 |
tcttcactcgtgtattatattgcattctttctttacaacaatattggacgatcatttcttaattttatttagtctatagattaagccaatcaatctcatc |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41779429 |
tcttcactcgtgtattatattgcattctttctttaaaacaatattggatgatcatttcataattttatttagtctatagattaagccaatcaatctcatc |
41779330 |
T |
|
| Q |
404 |
tgaatcatatt |
414 |
Q |
| |
|
||||||||||| |
|
|
| T |
41779329 |
tgaatcatatt |
41779319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 41779714 - 41779651
Alignment:
| Q |
15 |
catgcataccataatttatagaaatggaatatgtagctacgagatatgatgctcatttctgtcc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41779714 |
catgcataccataatttatagaaatggaatatgtagctacgagatatgatgctcatttctgtcc |
41779651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University