View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5050_low_7 (Length: 238)
Name: NF5050_low_7
Description: NF5050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5050_low_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 238
Target Start/End: Original strand, 32763336 - 32763564
Alignment:
| Q |
10 |
catcatcatgacctgtacatatgttttgtagcagctagctcatatgaaaaatatttattaaggactgaaacaagagaatcaaatcatgaaaataattttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32763336 |
catcatcatgacctgtacatatgttttgtagcagctagctcatatgaaaaatatttattaaggactgaaacaagagaatcaaatcatgaaaataattttg |
32763435 |
T |
|
| Q |
110 |
gttctcttaagatcatgaaaagttgttctagatagatttggctaatacattattgtccttgaaagaaggaagtggtcacattagcctatctattctttaa |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32763436 |
gttctcttaagatcatgaaaaattgttctagttggattttgctaatacattattgtccttgaaagaaggaagtggtcacattagcctatctattctttaa |
32763535 |
T |
|
| Q |
210 |
aatttcagtactcatagcttatgaagatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32763536 |
aatttcagtactcatagcttatgaagatt |
32763564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University