View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5051-Insertion-8 (Length: 180)
Name: NF5051-Insertion-8
Description: NF5051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5051-Insertion-8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 46440914 - 46441086
Alignment:
| Q |
8 |
aacatgactgtgaccaaagaacaattcaacttattttacaatgttgacaggcaactcttcactcgtttggtggtggggcttggccgtgaggcttttcaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46440914 |
aacatgactgtgaccaaagaacaattcaacttattttacaatgttgacaggcaactcttcactcgtttggtggtggggcttggccgtgaggcttttcaat |
46441013 |
T |
|
| Q |
108 |
cgataaatgtaatggctttcttgatgtggattgagtggataagtaaagatggtaatttagtagcaaatattct |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441014 |
cgataaatgtaatggctttcttgatgtggattgagtggataagtaaagatggtaatttagtagcaaatattct |
46441086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 142
Target Start/End: Complemental strand, 18331725 - 18331599
Alignment:
| Q |
16 |
tgtgaccaaagaacaattcaacttattttacaatgttgacaggcaactcttcactcgtttggtggtggggcttggccgtgaggcttttcaatcgataaat |
115 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||| |||||| | |||||||||||||||||| |||| | ||||| |||||| | ||| || |||||| |
|
|
| T |
18331725 |
tgtgaccaaagaagaatttaacttgttttacagtgttgatcgacaactcttcactcgtttgctggtcgcgcttgatcgtgagatctctcagtcaataaat |
18331626 |
T |
|
| Q |
116 |
gtaatggctttcttgatgtggattgag |
142 |
Q |
| |
|
|||||||| ||| | |||||| ||||| |
|
|
| T |
18331625 |
gtaatggccttcctcatgtggcttgag |
18331599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University