View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5051_high_6 (Length: 247)
Name: NF5051_high_6
Description: NF5051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5051_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 16 - 147
Target Start/End: Complemental strand, 51115566 - 51115435
Alignment:
| Q |
16 |
atacacacatgcaaagacagtaaaggggagggggacttacttaggttatggatttctagagaggattgaggaaggcagaattttcttccttccttgactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115566 |
atacacacatgcaaagacagtaaaggggagggggacttacttaggttatggatttctagagaggattgaggaaggcagaattttcttccttccttgactt |
51115467 |
T |
|
| Q |
116 |
gttcattatatactctttctttctgttgattc |
147 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
51115466 |
gttcgttatatactctttctttctgttgattc |
51115435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 197 - 247
Target Start/End: Complemental strand, 51115438 - 51115388
Alignment:
| Q |
197 |
attctctaatttttcttattaagaatagttggttgataagtaagttagtct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115438 |
attctctaatttttcttattaagaatagttggttgataagtaagttagtct |
51115388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 101
Target Start/End: Original strand, 640083 - 640136
Alignment:
| Q |
48 |
ggacttacttaggttatggatttctagagaggattgaggaaggcagaattttct |
101 |
Q |
| |
|
|||||| ||| |||||| ||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
640083 |
ggacttcctttggttatagatttctcgaggggattgaggaagacagaattttct |
640136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University