View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5051_low_10 (Length: 214)
Name: NF5051_low_10
Description: NF5051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5051_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 105 - 202
Target Start/End: Original strand, 5593464 - 5593561
Alignment:
| Q |
105 |
ctttcaactcctcccttcaaccaggttcattctttatctcttttactttctttcttacctctcttaaattaatttaatctaattgcttaatattcttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5593464 |
ctttcaactcctcccttcaaccaggttcattctttatctcttttactttctttgttacctctcttaaattaatttaatctaattgcttaatattcttc |
5593561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 105 - 202
Target Start/End: Complemental strand, 48124906 - 48124809
Alignment:
| Q |
105 |
ctttcaactcctcccttcaaccaggttcattctttatctcttttactttctttcttacctctcttaaattaatttaatctaattgcttaatattcttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48124906 |
ctttcaactcctcccttcaaccaggttcattctttatctcttttactttctttgttacctctcttaaattaatttaatctaattgcttaatattcttc |
48124809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University