View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5052_high_7 (Length: 277)
Name: NF5052_high_7
Description: NF5052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5052_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 38119050 - 38118805
Alignment:
| Q |
16 |
atgagtgcactggcacagtattcttcataatggggttcaccaaattataattttttgggtctttgttcgcatcaaactttccctttccatatccaagtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38119050 |
atgagtgcactggcacagtattcttcataatggggttcaccaaattataattttttgggtctttgttcgcatcaaactttccctttccatatccaagtac |
38118951 |
T |
 |
| Q |
116 |
ccaaaaatcatgtccatgaagatgccaaggatgtgtctcactattatttttattcatagtgtttgcattttgaagtataatatccacagttgtattgaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118950 |
ccaaaaatcatgtccatgaagatgccaaggatgtgtctcactgttatttttattcatagtgtttgcattttgaagtataatatccacagttgtattgaac |
38118851 |
T |
 |
| Q |
216 |
ttcagtctataaattccattgctagaagtagcatttgtgttgttag |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118850 |
ttcagtctataaattccattgctagaagtagcatttgtgttgttag |
38118805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University