View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5052_low_13 (Length: 241)
Name: NF5052_low_13
Description: NF5052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5052_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 114
Target Start/End: Complemental strand, 5439032 - 5438940
Alignment:
| Q |
22 |
gagttagggtaaaagtgaataaaagaatgagtgaaggtggtgctgatcacggttcttctccaaagctttataatcacaaacccaaaatatgta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5439032 |
gagttagggtaaaagtgaataaaagaatgagtgaaggtggtgctgatcacggttcttctccaaagctttataatcacaaacccaaaatatgta |
5438940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 187 - 240
Target Start/End: Complemental strand, 5438868 - 5438815
Alignment:
| Q |
187 |
taacagcgcaactgaagcaatttcaagggcagaaatcgaacgaattctcttcgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5438868 |
taacagcgcaactgaagcaatttcaagggcagaaatcgaacgagttctcttcgc |
5438815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 25 - 114
Target Start/End: Complemental strand, 5432558 - 5432463
Alignment:
| Q |
25 |
ttagggtaaaagtgaataaaagaatgagtgaaggtg------gtgctgatcacggttcttctccaaagctttataatcacaaacccaaaatatgta |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| | |||||||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
5432558 |
ttagggtaaaagtgaagaaaagaatgagtgaaggtggtggtagtgctgatcatgcttcttctccaaaactatataatcacaaacccaaaaaatgta |
5432463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 5432384 - 5432327
Alignment:
| Q |
187 |
taacagcgcaactgaagcaatttcaagggca---gaaatcgaacgaattctcttcgcc |
241 |
Q |
| |
|
|||||||||| ||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
5432384 |
taacagcgcagctgaagcaatttcgaggccaacagaaatcgaacgaattctcttcgcc |
5432327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University