View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5052_low_5 (Length: 324)
Name: NF5052_low_5
Description: NF5052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5052_low_5 |
 | |
|
| [»] scaffold0186 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 13 - 306
Target Start/End: Original strand, 33199723 - 33200015
Alignment:
| Q |
13 |
aaaatacaaatattaaactaaaaattgaatatttataattttagaatatcaaaactcaaaattataactttattaattctatttctacttcaagnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33199723 |
aaaatacaaatattaaactaaaaattgaatatttataattttagaatatcaaaactcaaaattataactttattaattctatttctacttaaagaaaaaa |
33199822 |
T |
|
| Q |
113 |
ngaggtaccacttaaaaaggattggtacatgcttgtaccacaacaagctcacagcagagtataccatcactcccacaccccaaacaatggcacccagcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33199823 |
-gaggtaccacttaaaaaggattggtacatgcttgtaccacaacaagctcacagcagagtataccatcactcccacatcccaaacaatggcacccagcat |
33199921 |
T |
|
| Q |
213 |
cttaccattgctagtaaaatatgaaaggcaacaaactataccacatatgtgtgagctgaattatatatgcttttatgcaacccgtggtagttga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33199922 |
cttaccattgctagtaaaatatgaaaggcaacaaactataccacatatgtgtgagctgaattatatatgcttttatgcaacccgtggtagttga |
33200015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0186 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 4143 - 4077
Alignment:
| Q |
13 |
aaaatacaaatattaaactaaaaattgaatatttataattttagaatatcaaaactcaaaattataac |
80 |
Q |
| |
|
|||||| |||||| |||||||||| | ||| |||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
4143 |
aaaatataaatatcaaactaaaaact-aatttttataattttataatattaaaactcaaagttataac |
4077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University