View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_high_12 (Length: 330)
Name: NF5053_high_12
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 13061674 - 13061887
Alignment:
| Q |
14 |
attattctagaatctcaattgaaaaactaggcagttgtaatctattttaaatttaggatttaatgtcttctgatcaaaactcccatttctatggaaattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13061674 |
attattctagaatctcaattgaaaaactaggcagttgtaatctattttaaatttaggatttaatgtcttctgatcaaaactcccatttctatggaaattt |
13061773 |
T |
 |
| Q |
114 |
atgtccataaatttgctggtcaaggttgttttgcacttgggattatactggtgtctagcacgtggttgctttgaggaagtcatcttcacagacatgggga |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13061774 |
atgtccataaatttgctagtcaaggttgttttgcacttgggattattctggtgtctagcacgtggttgctttgaggaagtcatcttcacagacatgggga |
13061873 |
T |
 |
| Q |
214 |
ttgaataattctca |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13061874 |
ttgaataattctca |
13061887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 258 - 310
Target Start/End: Original strand, 13061918 - 13061970
Alignment:
| Q |
258 |
cagttgctgtgtctgagactccaagcttatctcaatctcttttcactgcagtc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13061918 |
cagttgctgtgtctgagactccaagcttatctcaatctcttttcactgcagtc |
13061970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University