View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_high_32 (Length: 241)
Name: NF5053_high_32
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 13917827 - 13917605
Alignment:
| Q |
1 |
tatattccctcaaga-tgtgcgacttttgcaagagtaagagcacaaatgctctttgtctagtttaaggattcaaaaccatgtttctgtaatgtccaagga |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13917827 |
tatattccctcaagaatgtgcgacttttgcaagagtaagagcacaaatgctctttgtctagtttaaggattcaaaaccatgtttttgtaatgtcgaagga |
13917728 |
T |
 |
| Q |
100 |
cattctacctatatcgatgttatttaagaaatgggtttgagnnnnnnnnnnnnnnnnngggtcttagccctttagtttctatgaaaataaggctattaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
13917727 |
cattctacctatatcgatgttatttaagaaatgggtttgagttttttcttttctttttgggtcttagcccttta-tttctatgaaaatgagcctattaat |
13917629 |
T |
 |
| Q |
200 |
tttaaatttgattaggagataaat |
223 |
Q |
| |
|
| |||||||||| |||||||||| |
|
|
| T |
13917628 |
tctaaatttgatcgggagataaat |
13917605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University