View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_high_33 (Length: 240)
Name: NF5053_high_33
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 29924061 - 29924271
Alignment:
| Q |
13 |
gcattgtcatgatcgcgggtccggtatctaacaacacctcctcttgaccaaatctatcacacatgttatgagtcattacacatggtagcaatatcccttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29924061 |
gcattgtcatgatcgcgggtccggtatctaacaacacctcctcttgaccaaatctatcacacatgttatgagtcattacacatggtagcaatatcccttt |
29924160 |
T |
|
| Q |
113 |
ctttttctacatgttctatttctatttcgatcacttctctccgcgttcattcaacgtttgtcattattttgggtctgcatgtgtttcaccgatgcctttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29924161 |
ctttttctacatgttctatttctatttcgatcacttctcttcgcgttcattcaacgtttgtcattattttgggtctgcatgtgtttcaccgatgcctttc |
29924260 |
T |
|
| Q |
213 |
catggccccat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
29924261 |
catggccccat |
29924271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 2 - 71
Target Start/End: Original strand, 10169487 - 10169556
Alignment:
| Q |
2 |
ccttcacttcagcattgtcatgatcgcgggtccggtatctaacaacacctcctcttgaccaaatctatca |
71 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10169487 |
ccttcactttagcatcgtcatgatagcgggtccggtatctaacaacacctcctcttgcccaaagctatca |
10169556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 1981825 - 1981896
Alignment:
| Q |
1 |
cccttcacttcagcattgtcatgatcgcgggtccggtatctaacaacacctcctcttgaccaaatctatcac |
72 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||| || |||||||| ||||||||||||||| ||||||| |
|
|
| T |
1981825 |
cccttaactttagcatcgtcatgatcgcgggtccagtgtctaacaatgtctcctcttgaccaaagctatcac |
1981896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University