View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_high_34 (Length: 239)
Name: NF5053_high_34
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 19317126 - 19317211
Alignment:
| Q |
18 |
gtggaggtgtctgctcttcctacgacggcagatgcaattgttataagatttccagagttttcactaatttactctcctatttattt |
103 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19317126 |
gtggaggtgtctgctcttcctacgacgacagttgcaattgttataagatttccagagttttcactaatttactctcctatttattt |
19317211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 19317206 - 19317255
Alignment:
| Q |
190 |
ttatttcactagttggtaatgtcaccaaattgaattcaagactttatgaa |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19317206 |
ttatttaactagttggtaatgtcaccaaattgaattcaagactttatgaa |
19317255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University