View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_high_42 (Length: 204)
Name: NF5053_high_42
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 32229783 - 32229943
Alignment:
| Q |
1 |
acacatcaagatcgatcgtgactttgagtttgacagtccattggttggctaataagattgaaataatgatataacatatataacatgtgtgtgggtgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32229783 |
acacatcaagatcgatcgtgactttgagtttgacagtccattggttggctaataagattgaaataatgatataac----ataacatgtgtgtgggtgaaa |
32229878 |
T |
 |
| Q |
101 |
ataagttccttaaggagatatttaactcatgttactctactattaccttgactttcgatatgata |
165 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32229879 |
ataaattccttaaggagatatttaactcatgttcctctactattaccttgactttcgatatgata |
32229943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University