View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5053_high_6 (Length: 453)

Name: NF5053_high_6
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5053_high_6
NF5053_high_6
[»] chr3 (3 HSPs)
chr3 (94-271)||(33494942-33495119)
chr3 (363-434)||(33494779-33494850)
chr3 (16-54)||(33495176-33495214)
[»] chr5 (1 HSPs)
chr5 (200-254)||(26144090-26144144)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 94 - 271
Target Start/End: Complemental strand, 33495119 - 33494942
Alignment:
94 aatttttagttgacttcttattatttgtgcttgcagctttatcatccttcagcactgaaattgtttgatcaaatattgtttagtgcaaaaggaaaacaga 193  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||    
33495119 aatttttagttgacttcttattatttgtgcttgcagctttatcacccttcagcactgaaattgtttgatcaaatattgtatagtgcaaaaagaaaacaga 33495020  T
194 tagtgttttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagctttcatgactagaaagg 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33495019 tagtgttttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagctttcatgactagaaagg 33494942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 363 - 434
Target Start/End: Complemental strand, 33494850 - 33494779
Alignment:
363 atgaaactagatgagagcaacacttaaagatatagcaagaaatttcccaacagccatcgtgacaggaaggtg 434  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33494850 atgaaactagatgagagcaacacttaaagatatagcaagaaatttcccaacagccatcgtgacaggaaggtg 33494779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 33495214 - 33495176
Alignment:
16 tcagaaaatcaggaaaaatgttcttggattgtaagcata 54  Q
    |||||||||||||||||||||||||||||||||||||||    
33495214 tcagaaaatcaggaaaaatgttcttggattgtaagcata 33495176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 200 - 254
Target Start/End: Complemental strand, 26144144 - 26144090
Alignment:
200 tttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagc 254  Q
    ||||||||||||||||||| |||||||| || ||||| || |||||||| |||||    
26144144 tttttcttgactatgatggaactctctccccaattgtagcagatccagataaagc 26144090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University