View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_27 (Length: 268)
Name: NF5053_low_27
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 252
Target Start/End: Complemental strand, 37025341 - 37025101
Alignment:
| Q |
12 |
atgagaagttgagactgaaaagattacctttaagtccaaagtttgcaacatttacaattgtcacagaatttgtttcatcacaaacaattccttcccaatt |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025341 |
atgagaagttgagactgaaaagagtacctttaagtccaaagtttgcaacatttacaattgtcacagaatttgtttcatcacaaacaattccttcccaatt |
37025242 |
T |
|
| Q |
112 |
gcaaggacttgaaaaggttgtccaagaagataatgaagcttggctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactaccttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025241 |
gcaaggacttgaaaaggttgtccaagaagataatgaagcttggctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactaccttta |
37025142 |
T |
|
| Q |
212 |
tcttttgtagcattagttgcagcaaaactgaaaatgccata |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025141 |
tcttttgtagcattagttgcagcaaaactgaaaatgccata |
37025101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 33042246 - 33042297
Alignment:
| Q |
155 |
ctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactac |
206 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||| ||||||| |||| |
|
|
| T |
33042246 |
ctttgcttgtcaaggttggatttccaattcaatagagcacttgcttctctac |
33042297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University