View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_29 (Length: 252)
Name: NF5053_low_29
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 9244380 - 9244593
Alignment:
| Q |
23 |
tggtgatttgatttccttagcttcagccatgtgtttcctcactttgttctcttgtttttccacacctactgtatgtgttgcactttggatgtttatatag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9244380 |
tggtgatttgatttccttagcttcagccatgtgtttcctcactttgttctcttgtttttccacacctactgtatgtgttgcactttggatgtttatatag |
9244479 |
T |
 |
| Q |
123 |
atgggtgtggaagaattaatgtatataatatactaaagagattaattgttatgtataggtgagtagaatatttttacatatattatattaatgcaataaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9244480 |
atgggtgtggaagaattaatgtatataatatactaaagagattaattgttatgtataggtgagtagaatatttttacatatattatattaatgcaataaa |
9244579 |
T |
 |
| Q |
223 |
atgattttaaaatt |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9244580 |
atgattttaaaatt |
9244593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University