View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_33 (Length: 249)
Name: NF5053_low_33
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 26 - 231
Target Start/End: Original strand, 40811655 - 40811860
Alignment:
| Q |
26 |
ttgtcacacaaataaactaaatgcattttacccatccctccagttgaggggattataaataagtgcatgaaacataactttaagattcattttattagga |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40811655 |
ttgtcacacaaataaactaaatgcattttacccatccctccggttgaggggattataaataattgcatgaaacataactttaagattcattttattagaa |
40811754 |
T |
 |
| Q |
126 |
gacaaaccaacatagtagaccatgaattagcaaaaatagctcgtttgtatgatggtcaccaaattcctcatcattatccaccttatatagagactgttat |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
40811755 |
gacaagccaacatagtagaccatgaattagcaaaaatagctcgtttgtatgatggtcaccaaattcctcattattatccaccttatatagaaactgttat |
40811854 |
T |
 |
| Q |
226 |
tactag |
231 |
Q |
| |
|
|||||| |
|
|
| T |
40811855 |
tactag |
40811860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University