View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_34 (Length: 246)
Name: NF5053_low_34
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 31646078 - 31646300
Alignment:
| Q |
2 |
gcgttacctttgtagtctaaatatgttgttagtatggtatatatggttataaa-----ttatatatgccaaaaacaacaacatatgatagcgataagaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646078 |
gcgttacctttgtagtctaaatatgttgttagtatggtatatatggttataaattaaattatatatgccaaaaacaacaacatatgatagcgataagaat |
31646177 |
T |
 |
| Q |
97 |
ggtattactagctatacaatcttgaataaccaattggtcaaaaaataatatcttgaataaccagatagtgaaataacgagaaattaagaatcaaatcacc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
31646178 |
ggtattactagctatacaatcttgaataaccaattggtcaaaaaataatatcttgaataactagatagggaaataacgagaaattaagaattaaatcacc |
31646277 |
T |
 |
| Q |
197 |
aatctggcttttgtccagacatg |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31646278 |
aatctggcttttgtccagacatg |
31646300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University