View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5053_low_38 (Length: 239)

Name: NF5053_low_38
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5053_low_38
NF5053_low_38
[»] chr2 (2 HSPs)
chr2 (18-103)||(19317126-19317211)
chr2 (190-239)||(19317206-19317255)


Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 19317126 - 19317211
Alignment:
18 gtggaggtgtctgctcttcctacgacggcagatgcaattgttataagatttccagagttttcactaatttactctcctatttattt 103  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19317126 gtggaggtgtctgctcttcctacgacgacagttgcaattgttataagatttccagagttttcactaatttactctcctatttattt 19317211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 19317206 - 19317255
Alignment:
190 ttatttcactagttggtaatgtcaccaaattgaattcaagactttatgaa 239  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||    
19317206 ttatttaactagttggtaatgtcaccaaattgaattcaagactttatgaa 19317255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University