View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_40 (Length: 231)
Name: NF5053_low_40
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_40 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0280 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 10791 - 11007
Alignment:
| Q |
15 |
atttacaaccgatacaagtgctactagagtcagagctgttccaatgtattgctttagcatggatacattggatgaattaaatttataccgcccaggaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10791 |
atttacaaccgatacaagtgctactagagtcagagctgttccaatgtattgctttagcatggatacattggatgaattaaatttataccgcccaggaaaa |
10890 |
T |
|
| Q |
115 |
tgcccaactataggaattttgccatcgggtcttccatgggtaaagaaatctcttaaaaagaacgagtttcttactggttcttttttgacatcgcgttata |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10891 |
tgcccaactataggaattttgccatcaggtcttccatgggtaaagaaatcccttaaaaagaacgagtttctttctggttcttttttgacattgcgttata |
10990 |
T |
|
| Q |
215 |
agagacgcagatgtgac |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10991 |
agagacgcagatgtgac |
11007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 21915607 - 21915811
Alignment:
| Q |
15 |
atttacaaccgatacaagtgctactagagtcagagctgttccaatgtattgctttagcatggatacattggatgaattaaatttataccgcccaggaaaa |
114 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||||||||||| ||||||||| | | |||||||| | |||||||||| | | |
|
|
| T |
21915607 |
atttacaacagatacaaccgttactagagtcagagctgttccaatgtatagctttagcaggaaaacattggagggattaaattta------------ata |
21915694 |
T |
|
| Q |
115 |
tgcccaactataggaattttgccatcgggtcttccatgggtaaagaaatctcttaaaaagaacgagtttcttactggttcttttttgacatcgcgttata |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| ||| ||| || |
|
|
| T |
21915695 |
cgcccaactataggaattttgccatcaggtcttccatgggtaaagaaatcccttaaaaagaacgagtttctctctggttcttttttgacgtcgggttcta |
21915794 |
T |
|
| Q |
215 |
agagacgcagatgtgac |
231 |
Q |
| |
|
||||| |||| |||||| |
|
|
| T |
21915795 |
agagaagcaggtgtgac |
21915811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University