View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_43 (Length: 218)
Name: NF5053_low_43
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 197
Target Start/End: Complemental strand, 45242279 - 45242100
Alignment:
| Q |
20 |
tctgcaactgctatttcataaattttggttcaacctgtgttagttgtacggtagtgttgtttgggtttaatatatcaaatttaaatatggtatg--tata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45242279 |
tctgcaactgctatttcataaattttggttcaacctgtgttagttgtacggtagtgttgtttgggtttaatatatcaaatttaaatatggtatgtatata |
45242180 |
T |
|
| Q |
118 |
ggatgaatatatggtgatttcgacacaccttgtttgtgtcacgtgacacggttaagtcatgcttgatcaattatctgttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45242179 |
ggatgaatatatggtgatttcgacacaccttgtttgtgtcacgtgacacggttaagtcatgcttgatcaattatctgttc |
45242100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 11425447 - 11425493
Alignment:
| Q |
41 |
attttggttcaacctgtgttagttgtacggtagtgttgtttgggttt |
87 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
11425447 |
attttggttcaacacgtgttagtcgtatggtagtgttgtttgggttt |
11425493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University