View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_5 (Length: 477)
Name: NF5053_low_5
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 9e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 329 - 459
Target Start/End: Original strand, 2022696 - 2022826
Alignment:
| Q |
329 |
ccattgattgagagagagaagctacctctggctttcttgccgatgtcagtgtagagaccgggacccttagcagccatagctagattcggtggaaacgaag |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2022696 |
ccattgattgagagagagaagctacctctggctttcttgccgatgtcagtgtagagaccgggacccttagcagccatagctagattcggtggaaacgaag |
2022795 |
T |
 |
| Q |
429 |
attcttgaagctgagttttgtgtgatgaaac |
459 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2022796 |
attcttgaagctgagttttgtgtgatgaaac |
2022826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 2022366 - 2022435
Alignment:
| Q |
13 |
aaaatcaaagctttccaacaatacccataacaaaattcatcaaaataacatgacttaaccatacatgaag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2022366 |
aaaatcaaagctttccaacaatacccataacaaaattcatcaaaataacatgacttaaccatacatgaag |
2022435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 3211502 - 3211547
Alignment:
| Q |
351 |
tacctctggctttcttgccgatgtcagtgtagagaccgggaccctt |
396 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
3211502 |
tacctctggcttttttgccgatgtcagagtagagacctggaccctt |
3211547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University