View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5053_low_5 (Length: 477)

Name: NF5053_low_5
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5053_low_5
NF5053_low_5
[»] chr7 (2 HSPs)
chr7 (329-459)||(2022696-2022826)
chr7 (13-82)||(2022366-2022435)
[»] chr6 (1 HSPs)
chr6 (351-396)||(3211502-3211547)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 9e-68; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 329 - 459
Target Start/End: Original strand, 2022696 - 2022826
Alignment:
329 ccattgattgagagagagaagctacctctggctttcttgccgatgtcagtgtagagaccgggacccttagcagccatagctagattcggtggaaacgaag 428  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2022696 ccattgattgagagagagaagctacctctggctttcttgccgatgtcagtgtagagaccgggacccttagcagccatagctagattcggtggaaacgaag 2022795  T
429 attcttgaagctgagttttgtgtgatgaaac 459  Q
    |||||||||||||||||||||||||||||||    
2022796 attcttgaagctgagttttgtgtgatgaaac 2022826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 2022366 - 2022435
Alignment:
13 aaaatcaaagctttccaacaatacccataacaaaattcatcaaaataacatgacttaaccatacatgaag 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2022366 aaaatcaaagctttccaacaatacccataacaaaattcatcaaaataacatgacttaaccatacatgaag 2022435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 3211502 - 3211547
Alignment:
351 tacctctggctttcttgccgatgtcagtgtagagaccgggaccctt 396  Q
    ||||||||||||| ||||||||||||| ||||||||| ||||||||    
3211502 tacctctggcttttttgccgatgtcagagtagagacctggaccctt 3211547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University