View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5053_low_6 (Length: 453)
Name: NF5053_low_6
Description: NF5053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5053_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 94 - 271
Target Start/End: Complemental strand, 33495119 - 33494942
Alignment:
| Q |
94 |
aatttttagttgacttcttattatttgtgcttgcagctttatcatccttcagcactgaaattgtttgatcaaatattgtttagtgcaaaaggaaaacaga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33495119 |
aatttttagttgacttcttattatttgtgcttgcagctttatcacccttcagcactgaaattgtttgatcaaatattgtatagtgcaaaaagaaaacaga |
33495020 |
T |
 |
| Q |
194 |
tagtgttttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagctttcatgactagaaagg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495019 |
tagtgttttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagctttcatgactagaaagg |
33494942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 363 - 434
Target Start/End: Complemental strand, 33494850 - 33494779
Alignment:
| Q |
363 |
atgaaactagatgagagcaacacttaaagatatagcaagaaatttcccaacagccatcgtgacaggaaggtg |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33494850 |
atgaaactagatgagagcaacacttaaagatatagcaagaaatttcccaacagccatcgtgacaggaaggtg |
33494779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 33495214 - 33495176
Alignment:
| Q |
16 |
tcagaaaatcaggaaaaatgttcttggattgtaagcata |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495214 |
tcagaaaatcaggaaaaatgttcttggattgtaagcata |
33495176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 200 - 254
Target Start/End: Complemental strand, 26144144 - 26144090
Alignment:
| Q |
200 |
tttttcttgactatgatggtactctctcacctattgttgccgatccagaaaaagc |
254 |
Q |
| |
|
||||||||||||||||||| |||||||| || ||||| || |||||||| ||||| |
|
|
| T |
26144144 |
tttttcttgactatgatggaactctctccccaattgtagcagatccagataaagc |
26144090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University