View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054-Insertion-14 (Length: 229)
Name: NF5054-Insertion-14
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054-Insertion-14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 148 - 225
Target Start/End: Complemental strand, 33398136 - 33398059
Alignment:
| Q |
148 |
gataaagcacgttcctcttcatcaattcaaggtcttgctctttcatatttggagatttcgtttactctcccccaacac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398136 |
gataaagcacgttcctcttcatcaattcaaggtcttgctctttcatatttggagatttcgtttactctcccccaacac |
33398059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 54 - 148
Target Start/End: Complemental strand, 33398276 - 33398170
Alignment:
| Q |
54 |
acgttttctcaaaatccaaagaattctctatttttctctttactcctcccc------------tcttcaaactcgtaaacaaagcgaaagggttttgttt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398276 |
acgttttctcaaaatccaaagaattctctatttttctctttactcctccccacatacctcccctcttcaaactcgtaaacaaagcgaaagggttttgttt |
33398177 |
T |
|
| Q |
142 |
ggtgttg |
148 |
Q |
| |
|
||||||| |
|
|
| T |
33398176 |
ggtgttg |
33398170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 33398353 - 33398309
Alignment:
| Q |
11 |
ccttcatgctgatatcaaagccgcgatgagatgctttctggagac |
55 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33398353 |
ccttcatgctgatatcaaagccgcgatgcgatgctttctagagac |
33398309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University