View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054-Insertion-15 (Length: 72)
Name: NF5054-Insertion-15
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054-Insertion-15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 7 - 72
Target Start/End: Original strand, 4676919 - 4676984
Alignment:
| Q |
7 |
acctatccaatgattttcaccactgagttgttgccatttgtttgctatgttgctgctgttgtttgg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4676919 |
acctatccaatgattttcaccactgagttgttgccatttgtttgctatgctgctgctgttgtttgg |
4676984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University