View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054-Insertion-19 (Length: 55)
Name: NF5054-Insertion-19
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054-Insertion-19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 19056520 - 19056567
Alignment:
| Q |
8 |
ttatacaatatagtcacgacaattgtcaatttgttcaaccacatacga |
55 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19056520 |
ttatacaatatagtcacgataattgtcaatttgttcaaccacatacga |
19056567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University