View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054_high_8 (Length: 273)
Name: NF5054_high_8
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 12 - 114
Target Start/End: Complemental strand, 43013151 - 43013049
Alignment:
| Q |
12 |
atgaacttgggtgtacagaatgtcgttggtgatgagcaaagtggaaattaggtaggaatacgaagtatctaaatcacttttttgtccattctaaatcact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43013151 |
atgaacttgggtgtacagaatgtcgttggtgatgagcaaagtggaaattaggtaggaacacgaagtatctaaatcactttttggtccattctaaatcact |
43013052 |
T |
 |
| Q |
112 |
ttt |
114 |
Q |
| |
|
||| |
|
|
| T |
43013051 |
ttt |
43013049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University